Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

نویسندگان

  • Christine M Misquitta
  • Paromita Ghosh
  • James Mwanjewe
  • Ashok K Grover
چکیده

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Sarcoplasmic reticulum Ca pump mRNA stability in cardiac and smooth muscle: role of the 3 -untranslated region

Misquitta, Christine M., James Mwanjewe, Lin Nie, and Ashok K. Grover. Sarcoplasmic reticulum Ca2 pump mRNA stability in cardiac and smooth muscle: role of the 3 -untranslated region. Am J Physiol Cell Physiol 283: C560–C568, 2002. First published April 18, 2002; 10.1152/ ajpcell.00527.2001.—Stomach smooth muscle (SSM) and left ventricular muscle (LVM) express the sarco(endo)plasmic reticulum C...

متن کامل

Sarcoplasmic reticulum Ca(2+) pump mRNA stability in cardiac and smooth muscle: role of the 3'-untranslated region.

Stomach smooth muscle (SSM) and left ventricular muscle (LVM) express the sarco(endo)plasmic reticulum Ca(2+)-ATPase (SERCA) pump gene SERCA2. Alternative splicing yields two major isoforms, SERCA2a in LVM and slow twitch muscle and SERCA2b in SSM and most other tissues. The splices have different 3'-untranslated regions (UTR) and also encode proteins that differ slightly in their COOH-terminal...

متن کامل

Regulation of SERCA Ca2+ pump expression by cytoplasmic Ca2+ in vascular smooth muscle cells.

Vascular smooth muscle cells (VSMC) express three isoforms of the sarcoplasmic or endoplasmic reticulum Ca2+-ATPase (SERCA) pump; SERCA2b predominates (91%), whereas SERCA2a (6%) and SERCA3 (3%) are present in much smaller amounts. Treatment with thapsigargin (Tg) or A-23187 increased the level of mRNA encoding SERCA2b four- to fivefold; SERCA3 increased about 10-fold, whereas SERCA2a was uncha...

متن کامل

I-52: Maternal mRNA Metabolism duringOocyte-to-Zygote Transition

Background: Maternal mRNA degradation is a selective process that occurs in waves corresponding to important developmental transitions such as resumption of meiosis, fertilization and zygotic genome activation. It has been demonstrated that the number, position, and combination of 3 UTR cis-acting elements interacting with trans-acting protein factors regulate translation and mRNA stability. Ou...

متن کامل

Multiple Export Mechanisms for mRNAs

Nuclear mRNA export plays an important role in gene expression. We describe the mechanisms of mRNA export including the importance of mRNP assembly, docking with the nuclear basket of the nuclear pore complex (NPC), transit through the central channel of the NPC and cytoplasmic release. We describe multiple mechanisms of mRNA export including NXF1 and CRM1 mediated pathways. Selective groups of...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • The Biochemical journal

دوره 388 Pt 1  شماره 

صفحات  -

تاریخ انتشار 2005